[ad_1] In C, in the result of the binary &, each bit depends on the two corresponding bits in the operands. If the bit in the same position is set (1) in both operands, it is set in the result. If it is clear (0) in either operand, it is clear in the result. For … Read more
[ad_1] These are just dummy files (implemented by the IDE) that serve documentation & autocomplete purposes for the builtin functions / classes. If you want to see how PHP works under the hood, take a look at its source code: https://github.com/php/php-src. If you want to extend PHP with custom functions, you can write an extension … Read more
[ad_1] Why is this fiddle not working? Many reasons. 1) CSS property background is not background-color 2) background-color is not red but rgb(255, 0, 0) Working code: $(document).ready(function(){ $(“.box”).click(function(){ if ($(“.box”).css(“background-color”) == “rgb(255, 0, 0)”) { $(“.box”).html(“Success!”); } }); }); Working Jsfiddle link Side note: debugging with console.log() is much more convenient than alert() Side … Read more
[ad_1] The concatenation operator in PHP is . not +. So change += to .=. 1 [ad_2] solved what`s wrong with this code? [closed]
[ad_1] For the record, for x = “TGAGGTAGTAGTTTGTGCTGTTAT TAGTAGTTTGTGCTGTTA TGAGGTAGTAGTTTGTAC TGAGAACTGAATTCCATAGG” a Biostrings solution is library(Biostrings) consensusMatrix(DNAStringSet(strsplit(x, “\n”)[[1]])) which will be fast for millions of sequences. [ad_2] solved frequency of letters at position in string [closed]
[ad_1] I fixed it for you: static void Main() { Class1 c1 = new Class1(); int a=1; c1.test(out a); } When calling a function that has an out or ref parameter, you need to pay some respect to that, by marking your parameter as out or ref as well. MSDN Reference Page To use an … Read more
[ad_1] SaveAs doesn’t return a string, or anything else. If you want the path in its own variable, string filepath = Server.MapPath(“~/UploadImages/”) + filename; ((FileUpload)row.FindControl(“FileUpload1”)).PostedFile.SaveAs(filepath); 1 [ad_2] solved Error cannot implicitly convert type ‘void’ to ‘string’ on string filepath [closed]
[ad_1] You need to use logical operators each time. IF you want to chack all strings to inequality to empty string then use String.IsNullOrEmpty() method instead of != operator. Also there is no reason to use () in your expression. You need to use brackets to prioritize operations but in your code there is no … Read more
[ad_1] Best way is, split your expression with “https://stackoverflow.com/” and get the 3rd index. 1 [ad_2] solved How to get part of the URL using java [closed]
[ad_1] Start with the wikipedia pages for each language. Then grab some reference books on each (the Camel book for Perl, obviously). Areas to consider might include: Approach to types Namespacing / variable scoping Module/Class/Package inclusion mechanisms argument passing semantics return value contexts (search for scalar/list context wrt perl) Multi-processing/multi-threading support/approaches Unicode support Standard libraries … Read more
[ad_1] 1) aggregate ag <- aggregate(count ~ ., cbind(count = 1, df), length) ag[do.call(“order”, ag), ] # sort the rows giving: userID A B count 3 1 2 2 1 4 1 3 3 1 2 3 2 1 2 1 5 1 0 2 The last line of code which sorts the rows could … Read more
[ad_1] 1) The queue transaction is rolled back, effectively moving the message back in front – therefore, it will be immediately retried. After 5 failed attempts (at least that is the default), Rebus will move the message to the error queue. The default retry mechanism is intentionally very swift – this way, the input queue … Read more
[ad_1] Login to your Apple developer account and accept updated license agreement: https://developer.apple.com/account Also you try from some different browser also or clear all history data from current browser. [ad_2] solved I Can’t accept updated apple developer license agreement [closed]
[ad_1] Your vector has zero length at start vector<int> binV; //zero length In this line of code for (int i = 0; i < binV.size(); i++){//some code} Will not run because binV is empty This expression is not correct if (input == 1 && input == 0) //not valid This && is logical and operator, … Read more
[ad_1] Why not try something like this. Of course, i have taken a bit of freedom on the design as you didnt provide any code. Hope this helps! private static Set<Node> getNodesFollowAllEdges(Node node) { Set<Node> nodes = getNodesFollowAllEdges(node, new HashSet<>()); // remember to remove the original node from the set nodes.remove(node); return nodes; } private … Read more