#columns 4 to the last one myselec<-mydata[ 1, 4 : ncol(mydata)] #put the columns you want to keep in a vector columnsIWantToKeep <- c(4, 5, 6, 10, 12) #subset your DFusing this vector myselec<-mydata[1, columnsIWantToKeep] The same applies to rows… myselec<-mydata[ 4:nrow(mydata),] #get from row 4 to the end myselec<-mydata[ c(1,3,5,7),] #get rows 1,3,5,7 You … Read more
You could use gsub here x<-c(“s1-112”, “s10-112”, “s3656-112”) gsub(“s(.*)-112”, “\\1”, x) # [1] “1” “10” “3656” 1 solved Changing a column of a dataframe in R
Create a Function and Find the Largest Value in the Dataset and Find its Position of Row and Column using an IF statement & a Loop [closed] solved Create a Function and Find the Largest Value in the Dataset and Find its Position of Row and Column using an IF statement & a Loop [closed]
I’m not sure there is enough information in your question for me to give you a specific answer, but here’s a start… You can extract the variable names from a data.frame called df with: names_vec <- names(df) You can get the desired pattern of variable names with plus signs between them with: string_1 <- paste(names_vec, … Read more
Since your column C1 is numeric, you should not use quotes. Try this: subset(KL, C1 > 300) ID C1 1 A 597.69 3 C 601.30 4 D 4052.60 15 O 354.12 But note that you should use caution with subset() – this will not always do what you think it does. It’s better to use … Read more
I will try to guess what is asked. Assuming that your data frame is named df, you can convert each column to matrix and put it in list using lapply(). For example, I converted to matrix with two columns. seq_len(ncol(df) will make sequence of numbers from 1 to number of columns, so conversion will iterate … Read more
Introduction This post provides a solution to the problem of converting a text file into a matrix. The solution involves using a combination of programming languages such as Python, R, and MATLAB to read the text file and then convert it into a matrix. The post also provides a step-by-step guide on how to do … Read more
From help(Trig): Angles are in radians, not degrees, for the standard versions (i.e., a right angle is π/2), and in ‘half-rotations’ for cospi etc. > cos(pi) [1] -1 > cos(2*pi) [1] 1 Mind that: > pi [1] 3.141593 solved cos/sin/tan function gives different result than my calculator [closed]
ggplot2 is my favourite R package, so here is how I would solve this: df = data.frame(difficulty = 2 + (runif(200) * 6), ID = rep(c(“point”, “bubble”), each = 100)) df$movement = rep(c(1.2, 1.4), each = 100) * df$difficulty + (runif(200) / 5) library(ggplot2) theme_set(theme_bw()) ggplot(df, aes(x = difficulty, y = movement, color = ID, … Read more
I’m assuming IATA is the ticket agent variable: df = data.frame(IATA=c(3300, 3300, 3300, 3300, 3301, 3301, 3302, 3303, 3303)) table(df$IATA) # 3300 3301 3302 3303 # 4 2 1 2 As you can see, table gives the frequency of ticket sales by each ticket agent. names(which.max(table(df$IATA))) # [1] “3300” If there are ties and you … Read more
###Use subset command:### dataframename <- subset(dataframename, select = -c(col1,col4) ) ###One more approach is you can use list(NULL) to the dataframe:### dataframename[,c(“col1″,”col4”)] <- list(NULL) solved Remove selected columns in R dataframe [duplicate]
Omit the + signs and it will work: divider <- function(x,y) { result <- x/y print(result) } 1 solved Error in function syntax [closed]
The example that you give is for plotting maps, usually starting from a shapefile. In that case the data contains a column named group which is used by geom_polygon to ensure that boundaries and shapes are connected correctly. If the column were named something else, e.g. xxx, then you’d use group = xxx. This question … Read more
It subsets the train dataset to only observations where label = 1. 3 solved Can someone explain the following snippet of R code? [closed]
For the record, for x = “TGAGGTAGTAGTTTGTGCTGTTAT TAGTAGTTTGTGCTGTTA TGAGGTAGTAGTTTGTAC TGAGAACTGAATTCCATAGG” a Biostrings solution is library(Biostrings) consensusMatrix(DNAStringSet(strsplit(x, “\n”)[[1]])) which will be fast for millions of sequences. solved frequency of letters at position in string [closed]